MICROSATELLITES (STRs)

Esquema de electroforesis de los marcadores usados en el proyecto, siguiendo el filtro D (matrix DS32) de Applied Biosistem (equipo abi377, ABI3xxx y ABI310)


DNA MITOCONDRIAL

La variabilidad del DNA mitocondrial a nivel de muchas razas domésticas a sido investigada mayormente a través de la secuenciación de la región de control. En ovino hay disponible en las base de datos varias secuencias. Las base de datos más completos son de Pedrosa et al 2007. y Tapio et al. 2006.

En nuestro proyecto nos proponemos un estudio más detallado de la variabilidad del ADN mitocondrial, estudiando secuencia entera (16.000) en la totalidad de los genes que la componen.

Para este estudio se llevará a cabo un ensayo de primer extencion sobre las mutaciones características de los cincos haplogrupos encontrado en la especie ovina (Haplogruppo A, B, C, D, E).


CROMOSOMA Y

El estudio sobre las secuencias específicas de los individuos de sexo masculino del cromosoma Y, permite completar el estudio evolutivo del ADN mitocondrial, que considera vías filogenética exclusivamente por vía materna. Meadows et al  2004 & 2006 han estudiado en varias razas Europeas e internacionales la variación de SNPs y STRS situado en el cromosoma Y ovino. Se ha descubierto una baja variabilidad relativamente a otras especies como el bovino, sin embargo muchos estudios son necesarios para indentificar más mutaciones (no siendo conocida la secuencia completa del cromosoma sexual ovino). Estudios han sido realizado en las razas ovinas comerciales, sin embargo en las ovinos criollos Iberoamericanos aún no han sido abordados.

 

Analisis of SNP oY1  y del microsatellites SRYM18

Genetic marker AY604734.2:g.67A>G (oY1) es un SNP posicionado en la region 5′ del promotor del gen ovino sex determining region Y (SRY). Los primer utilizado son SRY-U1 (AGCTCCAGAATATTTCACTGACCT) and SRY-D1 (GAAGGCAAATGCAGAGACAA) amplifican un fragmento de 130-bp  de la secuencia del gen (AY604734) y han sido publicados y testados por  Meadows et al 2004 & 2006.

El Microsatellite SRYM18 (Gill et al. 1999) està identifiecado por los primers SRYM18F (GGCATCACAAACAGGATCAGCAAT) and SRYM18R (GTGATGGCAGTTCTCACAATCTCCT) (Meadows et al. 2004). Su estructura es particular presentando un mutacion de singular base en el medio d ela secuencia  ([TTTTG]mG/−[TG]n).